p.1
Discovery of DNA and Nuclein
What method did Miescher use to extract nuclei?
He used alkali to extract the nuclei.
p.9
Hershey and Chase's Bacteriophage Experiments
How are phage genes described during the time the prophage is replicated?
They are inactive or repressed.
p.48
Bacterial Chromosomes and Plasmids
What does a relaxed molecule of DNA indicate?
It indicates that the DNA is not under torsional strain.
p.61
Bacterial Chromosomes and Plasmids
What is the typical structure of plasmids?
Most plasmids are supercoiled, giving them a condensed, compact form.
p.1
Discovery of DNA and Nuclein
What substance did Miescher discover while isolating nuclei from white blood cells?
Nuclein, which is largely DNA.
p.52
Bacterial Chromosomes and Plasmids
How does DNA gyrase affect positive supercoiling?
It relaxes positive supercoiling resulting from partial unwinding of a double helix.
p.24
Histone Modifications and Gene Regulation
What are the five main types of histones?
H1, H2A, H2B, H3, and H4.
What does the number 26 represent in this context?
It could refer to a quantity, age, or another numerical significance.
p.27
Nucleosomes and Chromatin Fiber Formation
What are nucleosomes packed together to form?
Chromatin fibers and chromosomes.
p.47
Eukaryotic DNA Packaging and Chromatin Structure
What happens when relaxed circular DNA is twisted in the opposite direction?
It becomes negatively supercoiled.
p.3
Griffith's Experiment and Genetic Transformation
What type of colonies does the S strain produce on solid agar medium?
Smooth and shiny colonies due to the mucous polysaccharide coat.
p.22
Watson and Crick's Double Helix Model
What do regulatory proteins need to do to recognize specific base sequences in A-RNA?
They generally need to unwind the duplex.
p.53
Watson and Crick's Double Helix Model
What is the process of separating the two strands of a DNA molecule called?
DNA denaturation (melting).
p.62
Bacterial Chromosomes and Plasmids
What do R factors in E. coli carry?
Genes that impart drug resistance to the bacterial cell.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance in various contexts.
p.29
Eukaryotic DNA Packaging and Chromatin Structure
What are polytene chromosomes?
Specialized types of chromosomes not associated with cell division.
p.47
Eukaryotic DNA Packaging and Chromatin Structure
What is the process of converting relaxed circular DNA into supercoiled DNA?
Twisting it in the opposite direction creates negatively supercoiled DNA, while twisting in the same direction creates positively supercoiled DNA.
p.56
Chargaff's Rules and Base Pairing
What happens to denatured DNA when the temperature is lowered?
It can be renatured (reannealed) as hydrogen bonds are reestablished.
p.56
Chargaff's Rules and Base Pairing
What is a key feature of DNA related to its base pairing?
Denatured DNA can be renatured by lowering the temperature.
p.1
Discovery of DNA and Nuclein
From where did Miescher obtain the white blood cells for his experiments?
From pus found on surgical bandages.
What does the number 56 represent?
It could represent a quantity, age, or another numerical value depending on the context.
p.65
Nucleosomes and Chromatin Fiber Formation
What is the length of DNA associated with the nucleosome core particle?
Approximately 146 base pairs (bp).
p.47
Eukaryotic DNA Packaging and Chromatin Structure
What happens when relaxed circular DNA is twisted in the same direction as the double helix?
It becomes positively supercoiled.
p.3
Griffith's Experiment and Genetic Transformation
What characteristic distinguishes the R strain colonies from the S strain colonies?
R strain colonies exhibit a rough boundary due to the lack of a mucous coat.
p.30
Histone Modifications and Gene Regulation
What are two common chemical modifications of histone tails?
Addition or removal of acetyl and methyl groups.
p.7
Hershey and Chase's Bacteriophage Experiments
What is the function of the protein tail of a phage?
To attach to a bacterium and inject DNA.
p.50
Eukaryotic DNA Packaging and Chromatin Structure
What do type I topoisomerases do to relax supercoiled DNA?
Introduce transient single-strand breaks in DNA.
p.53
Watson and Crick's Double Helix Model
How can DNA be commonly denatured in the laboratory?
By raising either the temperature or the pH.
p.49
Eukaryotic DNA Packaging and Chromatin Structure
What is negative supercoiling associated with?
Unwinding of the double helix, which increases access to proteins involved in DNA replication or transcription.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
What is the primary function of telomeres during replication?
To protect chromosomes from degradation at their vulnerable ends.
p.2
Griffith's Experiment and Genetic Transformation
What bacterium did Griffith study?
Pneumococcus, now known as Streptococcus pneumoniae.
p.6
Avery's Contribution to DNA as Genetic Material
What was the initial reaction to assigning a genetic role to DNA?
It was not immediately accepted.
p.59
Bacterial Chromosomes and Plasmids
What happens to DNA from ruptured bacterial cells?
It forms a series of loops that remain attached to a structural framework.
p.33
Histone Modifications and Gene Regulation
What do chemical modifications of histones promote?
The binding of additional proteins to DNA associated with 'open' or 'closed' chromatin.
p.3
Griffith's Experiment and Genetic Transformation
What conclusion did Griffith reach regarding the R strain and S strain bacteria?
Nonpathogenic R bacteria were converted into pathogenic S bacteria by a substance from heat-killed S bacteria.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
Is supercoiling restricted to circular DNA?
No, but it is easiest to study in circular DNA molecules.
p.32
Histone Modifications and Gene Regulation
What is acetylation in the context of histone structure?
The addition of acetyl groups to amino acid side chains.
p.58
Watson and Crick's Double Helix Model
What factors affect the time required for DNA reassociation?
DNA concentration in the solution and the number of unique sequences within the DNA strands.
p.36
Histone Modifications and Gene Regulation
What is facultative heterochromatin?
Heterochromatin that can be converted to euchromatin and vice versa.
p.23
Eukaryotic DNA Packaging and Chromatin Structure
What is chromatin?
DNA bound to proteins in eukaryotic cells.
p.12
Avery's Contribution to DNA as Genetic Material
What general rule do some viruses violate regarding genetic material?
That double-stranded DNA is the only carrier of genetic information.
p.9
Hershey and Chase's Bacteriophage Experiments
What is a prophage?
A phage that is replicated along with bacterial DNA and remains inactive or repressed.
p.9
Hershey and Chase's Bacteriophage Experiments
What happens to prophage DNA under certain conditions?
It is excised from the bacterial chromosome and enters a lytic cycle.
p.59
Bacterial Chromosomes and Plasmids
What is a nucleoid?
A distinct region in a bacterial cell where the bacterial chromosome resides.
p.22
Watson and Crick's Double Helix Model
Why is A-RNA not well suited for base recognition by RNA-binding proteins?
Because A-RNA has a narrower major groove.
p.14
Chargaff's Rules and Base Pairing
What do Chargaff's rules imply about purines and pyrimidines?
The number of purines is equal to the number of pyrimidines (A + G = C + T).
p.41
Bacterial Chromosomes and Plasmids
What are variable number tandem repeats (VNTRs)?
Shorter regions of tandemly repeated DNA.
p.25
Nucleosomes and Chromatin Fiber Formation
What gives chromatin fibers their 'beads-on-a-string' appearance?
Nucleosomes attached by thin filaments of DNA.
p.30
Histone Modifications and Gene Regulation
What effect does histone methylation have on nucleosome packing?
It favors tighter packing.
p.55
Watson and Crick's Double Helix Model
What is the DNA melting temperature (Tm)?
The temperature at which one-half of the absorbance change has been achieved, or the thermal midpoint of denaturation.
p.25
Nucleosomes and Chromatin Fiber Formation
What do the 'beads' in the 'beads-on-a-string' model consist of?
Proteins, presumably histones.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
What is the purpose of extensive supercoiling during cell division?
To make the DNA more compact.
What is the significance of the date 9/29/2024?
It appears to be a specific date, possibly indicating an event or deadline.
p.61
Bacterial Chromosomes and Plasmids
What are plasmids?
Relatively small, usually circular molecules of DNA that carry genes for their own replication and often for nonessential cellular functions.
p.56
Chargaff's Rules and Base Pairing
What does proper base pairing in DNA strands affect?
It leads to a higher melting temperature.
p.59
Bacterial Chromosomes and Plasmids
Where is the bacterial chromosome localized within the cell?
In a special region called the nucleoid.
p.14
Chargaff's Rules and Base Pairing
What is Chargaff's most striking observation about DNA?
The number of adenines is equal to the number of thymines (A = T), and the number of guanines is equal to the number of cytosines (G = C).
p.6
Avery's Contribution to DNA as Genetic Material
What alleviated doubts about DNA being the genetic material?
It was shown to be the genetic material of the bacteriophage T2.
p.35
Eukaryotic DNA Packaging and Chromatin Structure
Is heterochromatin transcriptionally active or inactive?
Transcriptionally inactive.
p.30
Histone Modifications and Gene Regulation
What effect does histone acetylation have on nucleosome packing?
It favors looser packing of nucleosomes.
p.43
Bacterial Chromosomes and Plasmids
What are SINEs?
Short interspersed nuclear elements that consist of short repeated sequences less than 500 bp in length and do not contain genes.
p.52
Bacterial Chromosomes and Plasmids
What does DNA gyrase do to promote strand separation?
It actively introduces negative supercoils.
p.43
Bacterial Chromosomes and Plasmids
How do SINEs move within the genome?
They rely on enzymes made by other mobile elements for their movement.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance for events or deadlines.
p.48
Bacterial Chromosomes and Plasmids
What type of DNA molecules are shown in Figure 18 - 6 b?
Circular DNA molecules from bacteriophage PM 2.
What does the number '24' refer to in the context of Figure 18-3?
It may indicate a specific detail or reference point within the figure.
p.7
Hershey and Chase's Bacteriophage Experiments
What are bacteriophages?
Viruses that infect bacteria.
p.65
Nucleosomes and Chromatin Fiber Formation
What components make up a histone octamer?
Two H2A-H2B dimers and two H3-H4 dimers.
p.41
Bacterial Chromosomes and Plasmids
What is the maximum number of sequential repetitions of the GTTAC unit in the genome?
Several hundred thousand.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
Where else can circular DNA molecules be found besides viruses?
In bacteria, mitochondria, and chloroplasts.
p.19
Chargaff's Rules and Base Pairing
What characterizes DNA and RNA in terms of size?
They can be characterized by the number of base pairs.
p.32
Histone Modifications and Gene Regulation
What enzyme adds acetyl groups to histone molecules?
Histone acetyltransferase (HAT).
p.55
Watson and Crick's Double Helix Model
What role do hydrogen bonds play in DNA structure?
They stabilize the DNA and account for the specificity of base pairing across the double helix.
p.41
Bacterial Chromosomes and Plasmids
How are VNTRs useful in medical forensics?
They help identify individuals with particular genetic constitutions.
p.31
Histone Modifications and Gene Regulation
What does methylation of lysine 4 in histone H3 indicate?
It is a hallmark of most active genes.
p.49
Eukaryotic DNA Packaging and Chromatin Structure
What effect does negative supercoiling have on DNA strands?
It gives the strands increased access to proteins involved in DNA replication or transcription.
p.11
Hershey and Chase's Bacteriophage Experiments
What did Hershey and Chase conclude about the function of DNA?
DNA must function as the genetic material of phage T2.
What is the significance of Figure 18-2?
The content of Figure 18-2 is not provided, so its significance cannot be determined.
What does the number '6' refer to in the context of Figure 18-2?
The context of '6' is not provided, so its meaning cannot be determined.
p.27
Nucleosomes and Chromatin Fiber Formation
What is the significance of chromatin fibers?
They play a crucial role in packaging DNA into chromosomes.
p.57
Chargaff's Rules and Base Pairing
What is indicated by the relationship between Tm and G + C content?
It shows that DNA samples from various sources have different thermal denaturation midpoints based on their base composition.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
In which type of DNA was supercoiling first identified?
In the DNA of certain small viruses containing circular DNA molecules.
p.19
Chargaff's Rules and Base Pairing
Can RNA be measured in the same way as DNA?
Yes, RNA is often measured using the same terminology.
p.11
Hershey and Chase's Bacteriophage Experiments
What two types of radioactive labeling did Hershey and Chase use in their experiment?
They labeled phage proteins with 35S and phage DNA with 32P.
p.35
Eukaryotic DNA Packaging and Chromatin Structure
What is euchromatin associated with?
DNA that is being actively transcribed.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
When does supercoiling occur in linear DNA molecules?
When DNA is packaged into chromosomes during cell division.
p.33
Histone Modifications and Gene Regulation
What do bromodomains bind to?
Acetylated DNA associated with 'open' chromatin.
p.30
Histone Modifications and Gene Regulation
What is the significance of the overall pattern of histone modifications?
It leads to changes in the activity of the associated DNA, known as the 'histone code.'
What does the number 7 represent in various contexts?
It can represent a quantity, a lucky number, or have cultural significance.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance depending on the context.
p.59
Bacterial Chromosomes and Plasmids
What is the most common arrangement of bacterial chromosomes?
A single circular DNA molecule bound to small amounts of protein.
p.61
Bacterial Chromosomes and Plasmids
Do plasmids replicate independently?
Yes, plasmids replicate autonomously with the replication of the bacterial chromosome.
p.46
Eukaryotic DNA Packaging and Chromatin Structure
What is supercoiled DNA?
DNA that has been twisted upon itself, forming a compact structure.
p.56
Chargaff's Rules and Base Pairing
What is the consequence of imperfect base pairing in DNA?
It results in a lower melting temperature.
p.18
Watson and Crick's Double Helix Model
What is a key feature of the DNA structure regarding its strands?
The two strands are twisted around each other, creating a major groove and a minor groove.
p.13
Chargaff's Rules and Base Pairing
What did Chargaff demonstrate about the percentage of bases in DNA from different cells of the same species?
The percentage of each of the four bases is the same.
p.35
Eukaryotic DNA Packaging and Chromatin Structure
What happens to chromatin as a cell prepares to divide?
All of its chromatin becomes highly compacted.
p.55
Watson and Crick's Double Helix Model
What is base stacking in DNA?
A major interaction within each of the single strands that stabilizes the DNA double helix.
p.32
Histone Modifications and Gene Regulation
What is the association of most histone acetylation?
It is associated with genes that are actively expressed or poised for expression.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
What is the sequence found in human telomeres?
TTAGGG, with 250 – 1500 copies.
p.28
Nucleosomes and Chromatin Fiber Formation
What is the next level of chromatin packaging after the 30-nm fiber?
Folding of the 30-nm fibers into DNA loops averaging 50,000 – 100,000 bp in length.
p.40
Eukaryotic DNA Packaging and Chromatin Structure
Why is it called satellite DNA?
Because its distinctive base composition causes it to appear in a 'satellite' band during centrifugation.
What does the number 62 represent?
It is unclear without additional context.
What is the significance of Figure 18-3?
It likely illustrates a specific concept or data relevant to the topic discussed.
What does the number 61 represent in this context?
It is unclear without additional context; it could refer to a quantity, age, or another identifier.
What is the significance of Table 18-1?
It likely contains important data or information relevant to a specific topic.
p.48
Bacterial Chromosomes and Plasmids
What is indicated by the presence of negative supercoils in DNA?
It suggests a certain level of torsional strain in the DNA structure.
p.59
Bacterial Chromosomes and Plasmids
What type of chromosomes can bacteria have?
Single or multiple, circular or linear chromosomes.
p.29
Eukaryotic DNA Packaging and Chromatin Structure
What do the chromatin loops in polytene chromosomes contain?
Active regions of DNA that are being transcribed.
What does the number '29' represent in this context?
It could refer to a specific entry or data point in Table 18-1.
p.29
Histone Modifications and Gene Regulation
Why is active DNA less tightly packed than inactive DNA?
To allow easier access by proteins involved in gene transcription.
p.57
Chargaff's Rules and Base Pairing
What does the melting temperature (Tm) of DNA depend on?
The G + C content of the DNA.
p.22
Watson and Crick's Double Helix Model
What is a key structural difference between A-type and B-type helices?
A-type helices have a wider minor groove and a narrower major groove than B-type helices.
p.9
Hershey and Chase's Bacteriophage Experiments
What does the lytic cycle produce?
Progeny phage particles and lyses the host cell.
p.2
Griffith's Experiment and Genetic Transformation
What disease is caused by the pathogenic strain of pneumococcus?
Fatal pneumonia in animals.
p.13
Chargaff's Rules and Base Pairing
What do Chargaff's Rules state about the base pairing in DNA?
Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).
p.62
Bacterial Chromosomes and Plasmids
What are F factors in E. coli?
Plasmids involved in the process of conjugation, a sexual process.
p.10
Hershey and Chase's Bacteriophage Experiments
What was the purpose of the Hershey and Chase experiment in 1952?
To determine which molecule carries genetic information to make new phage particles.
p.7
Hershey and Chase's Bacteriophage Experiments
What shape is the head of a T-even phage?
Hollow icosahedron (a 20-sided object).
p.52
Bacterial Chromosomes and Plasmids
What is one function of DNA gyrase?
It can induce and relax supercoiling.
p.58
Watson and Crick's Double Helix Model
What happens to native (double-stranded) DNA when heated slowly?
It 'melts' over a narrow temperature range, increasing absorbance at 260 nm.
p.21
Watson and Crick's Double Helix Model
What is the biological significance of Z-DNA?
Not well understood, but it may play a role in activating gene expression.
p.18
Watson and Crick's Double Helix Model
What is the orientation of the two DNA strands?
They have an antiparallel orientation.
p.12
Avery's Contribution to DNA as Genetic Material
What is a common type of virus that carries RNA as genetic material?
Tobacco mosaic virus (TMV).
p.58
Watson and Crick's Double Helix Model
What is indicated by an increase in absorbance at 260 nm during DNA denaturation?
The melting of double-stranded DNA.
p.32
Histone Modifications and Gene Regulation
What effect does histone acetylation have on chromatin?
It promotes chromatin decondensation, leading to 'open' chromatin.
p.50
Eukaryotic DNA Packaging and Chromatin Structure
What types of supercoils can both type I and type II topoisomerases remove?
Both positive and negative supercoils.
p.25
Nucleosomes and Chromatin Fiber Formation
What is referred to as a nucleosome?
Each bead along with its associated short stretch of DNA.
p.20
Watson and Crick's Double Helix Model
Why is Z-DNA named so?
Because of the zigzag pattern of its sugar-phosphate backbone.
p.38
Eukaryotic DNA Packaging and Chromatin Structure
What are the two main categories of repeated DNA classified by researchers?
Tandemly repeated DNA and interspersed repeated DNA.
p.16
Watson and Crick's Double Helix Model
What direction does the DNA helix curve?
Right-handed, curving 'upward' to the right.
p.16
Watson and Crick's Double Helix Model
Why is the diameter of the DNA helix significant?
It's too small for two purines and too great for two pyrimidines, but accommodates a purine and a pyrimidine.
p.53
Watson and Crick's Double Helix Model
What is the reverse process of DNA denaturation that reestablishes a double helix?
DNA renaturation (reannealing).
p.49
Eukaryotic DNA Packaging and Chromatin Structure
How does supercoiling influence DNA?
By affecting both the spatial organization and the energy state of DNA, which impacts its ability to interact with other molecules.
p.17
Chargaff's Rules and Base Pairing
Which bases pair together in DNA?
Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).
p.17
Chargaff's Rules and Base Pairing
What does the base sequence of one DNA chain determine?
The base sequence of the opposing chain.
p.34
Nucleosomes and Chromatin Fiber Formation
What do chromatin remodeling proteins do?
They alter the position of nucleosomes along DNA.
p.52
Bacterial Chromosomes and Plasmids
Does DNA gyrase require ATP to relax an already supercoiled molecule?
No, it does not require ATP for that.
p.11
Hershey and Chase's Bacteriophage Experiments
What conclusion did Hershey and Chase reach regarding genetic material?
DNA, not protein, had been injected into the bacterial cells.
p.62
Bacterial Chromosomes and Plasmids
What are cryptic plasmids in E. coli?
Plasmids with no known function and only the genes needed for replication and spread.
p.32
Histone Modifications and Gene Regulation
How can regulatory proteins influence DNA activity?
By recruiting complexes that contain enzymes like HAT and HDAC.
p.34
Histone Modifications and Gene Regulation
What is the relationship between histone acetylation and gene activity?
Histone acetylation is positively correlated with gene activity.
p.34
Nucleosomes and Chromatin Fiber Formation
What is the role of SWI/SNF remodelers in chromatin remodeling?
They couple changes in histones with chromatin remodeling.
p.54
Watson and Crick's Double Helix Model
What happens to double-stranded DNA when the temperature is raised?
It denatures into single strands.
p.18
Watson and Crick's Double Helix Model
Where do regulatory proteins often bind in the DNA structure?
To the major groove, recognizing specific base sequences without unfolding the DNA double helix.
p.62
Bacterial Chromosomes and Plasmids
What is the function of col factors in E. coli?
They allow the bacterium to secrete colicins, which kill other bacteria lacking the col factor.
p.53
Watson and Crick's Double Helix Model
What type of bonds hold the two strands of a DNA double helix together?
Relatively weak, noncovalent bonds.
p.40
Eukaryotic DNA Packaging and Chromatin Structure
What is tandemly repeated DNA?
DNA where multiple copies are arranged next to each other in a row.
p.31
Histone Modifications and Gene Regulation
What is one type of tagging reaction that involves histones?
Methylation of the amino acid lysine via histone methyltransferase.
p.20
Watson and Crick's Double Helix Model
What is a key characteristic of Z-DNA?
It is a left-handed double helix.
p.33
Histone Modifications and Gene Regulation
What is the relationship between histone modifications and chromatin structure?
Histone modifications influence whether chromatin is 'open' or 'closed'.
p.10
Hershey and Chase's Bacteriophage Experiments
What is the significance of the sugar-phosphate backbone in viral DNA?
It contains phosphorus, which helps distinguish DNA from protein.
p.43
Bacterial Chromosomes and Plasmids
What type of DNA accounts for surprisingly little of the human genome?
DNA that encodes proteins or gives rise to ribosomal or transfer RNAs, found in exons.
p.28
Nucleosomes and Chromatin Fiber Formation
What maintains the spatial arrangement of the DNA loops?
Periodic attachment of DNA to a chromosomal scaffold formed by nonhistone proteins.
p.14
Chargaff's Rules and Base Pairing
What are Chargaff's rules?
A = T and G = C, indicating specific base pairing in DNA.
p.50
Eukaryotic DNA Packaging and Chromatin Structure
How are topoisomerases classified?
As either type I or type II.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
Where are telomeres located?
At the tips of chromosomes.
p.31
Histone Modifications and Gene Regulation
What does the combination of tags on histones create?
A histone code that signals modifications of chromatin structure and gene activity.
p.41
Bacterial Chromosomes and Plasmids
What are microsatellite DNA or short tandem repeats (STRs)?
Even shorter repeats, about 10 – 100 bp in length, with repeat units of 1 – 10 bp.
p.50
Eukaryotic DNA Packaging and Chromatin Structure
What do type II topoisomerases do to relax supercoiled DNA?
Introduce transient double-strand breaks.
p.21
Watson and Crick's Double Helix Model
Under what conditions does A-DNA exist in significant amounts?
A-DNA does not exist in significant amounts under normal cellular conditions.
p.17
Chargaff's Rules and Base Pairing
What observation did Chargaff make regarding the amounts of bases in DNA?
DNA molecules contain equal amounts of A and T, and equal amounts of G and C.
p.34
Nucleosomes and Chromatin Fiber Formation
What effect do SWI/SNF remodelers have on DNA?
They make regions of DNA more accessible.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
Do all vertebrates have the same telomere sequence?
Yes, all studied vertebrates have the same sequence.
p.58
Watson and Crick's Double Helix Model
What occurs when the solution of DNA is allowed to cool after heating?
The separated DNA strands reassociate by random collisions and then 'zip up' complementary base pairs.
p.31
Histone Modifications and Gene Regulation
What is the function of the protruding tail on histone molecules?
It can be tagged by the addition of methyl, acetyl, phosphate, or other groups.
p.8
Hershey and Chase's Bacteriophage Experiments
What is the result of lytic growth?
Lysis of the host cell and production of many progeny phage particles.
p.20
Watson and Crick's Double Helix Model
What influences the exact shapes and dimensions of B-DNA double helices?
The local nucleotide sequence.
p.8
Hershey and Chase's Bacteriophage Experiments
What can a temperate phage do?
Produce lytic growth or integrate its DNA into the bacterial chromosome.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
What type of DNA sequences do telomeres contain?
Highly repetitive DNA sequences.
p.18
Watson and Crick's Double Helix Model
How are the phosphodiester bonds oriented in the two DNA strands?
They are oriented in opposite directions.
p.23
Eukaryotic DNA Packaging and Chromatin Structure
What are histones?
A group of relatively small proteins that play a crucial role in chromatin structure.
p.30
Chromatin Fiber Formation
What role do chromatin remodeling proteins play in relation to nucleosomes?
They can cause sliding of DNA within nucleosomes, exposing regions of DNA for gene activation.
p.60
Bacterial Chromosomes and Plasmids
What anchors the ends of each loop in bacterial DNA?
Structural components within the nucleoid.
p.60
Bacterial Chromosomes and Plasmids
What is the composition of the bacterial chromosome?
Supercoiled DNA bound to small, basic proteins, folded into looped domains.
p.54
Watson and Crick's Double Helix Model
What is measured to indicate the denaturation of DNA?
An increase in absorbance of light at 260 nm.
p.17
Chargaff's Rules and Base Pairing
What holds the two strands of DNA together?
Hydrogen bonding between the bases in opposite strands.
p.21
Watson and Crick's Double Helix Model
What type of helix is A-DNA?
A right-handed helix that is shorter and thicker than B-DNA.
p.23
Eukaryotic DNA Packaging and Chromatin Structure
How does DNA packaging in eukaryotes differ from that in bacteria?
DNA packaging in eukaryotes is more complicated due to larger amounts of DNA and greater structural complexity.
p.49
Eukaryotic DNA Packaging and Chromatin Structure
What is positive supercoiling?
It involves tighter winding of the double helix, reducing opportunities for interaction.
p.36
Histone Modifications and Gene Regulation
What role does facultative heterochromatin play during embryonic development?
It may inactivate entire blocks of genes.
p.34
Nucleosomes and Chromatin Fiber Formation
How do chromatin remodeling proteins function?
They couple ATP hydrolysis to changes in the organization and position of nucleosomes.
p.31
Histone Modifications and Gene Regulation
What is associated with gene silencing in histones?
Methylation of lysines 9 and 27.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
What additional role do telomeres play besides replication?
They recruit proteins involved in structural protection of chromosome tips.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
Do other eukaryotes have similar telomere sequences?
Yes, including unicellular eukaryotes.
p.60
Bacterial Chromosomes and Plasmids
What effect does nicking the DNA with a topoisomerase have?
It relaxes the supercoiling without disrupting the loops.
p.54
Watson and Crick's Double Helix Model
What is the melting temperature (Tm) of DNA?
The temperature at which the midpoint of absorbance increase occurs during denaturation.
p.62
Bacterial Chromosomes and Plasmids
What do virulence factors enhance in E. coli?
The ability to cause disease by producing toxic proteins or enzymes that allow entry into host cells.
p.8
Hershey and Chase's Bacteriophage Experiments
What is an example of a well-studied temperate phage?
Bacteriophage lambda (λ).
p.36
Histone Modifications and Gene Regulation
What are two important types of constitutive heterochromatin?
Centromeres and telomeres.
p.24
Histone Modifications and Gene Regulation
What roles do nonhistone proteins play in chromatin?
They play various enzymatic, structural, and regulatory roles.
p.60
Bacterial Chromosomes and Plasmids
How is the DNA of the bacterial chromosome structured?
It is negatively supercoiled and folded into loops averaging about 20,000 bp in length.
p.16
Watson and Crick's Double Helix Model
What are the sugar-phosphate backbones of the DNA strands positioned?
On the outside of the helix.
p.24
Histone Modifications and Gene Regulation
What is the relative abundance of histones in chromatin?
Roughly equal numbers of H2A, H2B, H3, and H4, with about half that number of H1.
p.33
Histone Modifications and Gene Regulation
Which important protein has bromodomains and is associated with gene transcription?
The transcription factor TFIID.
p.36
Histone Modifications and Gene Regulation
What is constitutive heterochromatin?
Heterochromatin that is permanently compacted and serves a structural function.
p.55
Watson and Crick's Double Helix Model
How does base stacking occur?
Through interactions between adjacent aromatic rings in organic compounds via hydrophobic and van der Waals interactions.
p.40
Eukaryotic DNA Packaging and Chromatin Structure
What is the typical length range of the repeated unit in satellite DNA?
From 1 to 2000 base pairs (bp).
p.55
Watson and Crick's Double Helix Model
What effect do adjacent GC dinucleotides have on DNA?
They tend to stabilize its shape.
p.62
Bacterial Chromosomes and Plasmids
What do metabolic plasmids produce in E. coli?
Enzymes required for certain metabolic reactions.
p.24
Histone Modifications and Gene Regulation
How constant are the proportions of histones among different eukaryotic cells?
They are remarkably constant regardless of cell type or physiological state.
p.38
Eukaryotic DNA Packaging and Chromatin Structure
Is all nonrepeated DNA involved in encoding proteins?
No, not all nonrepeated DNA encodes proteins.
p.32
Histone Modifications and Gene Regulation
What is the function of histone deacetylase (HDAC)?
It removes acetyl groups from histones.
p.23
Eukaryotic DNA Packaging and Chromatin Structure
Why do histones bind to DNA?
Histones have a strong positive charge that stabilizes their binding to negatively charged DNA through ionic bonds.
p.60
Bacterial Chromosomes and Plasmids
What forms a threadlike mass of fibers in bacterial DNA?
The bacterial chromosome in the nucleoid region.
p.42
Bacterial Chromosomes and Plasmids
What do LINEs code for?
Enzymes involved in copying LINE sequences and inserting copies elsewhere in the genome.
p.16
Watson and Crick's Double Helix Model
What do the bases in the DNA double helix do?
Face inward toward the center, forming the 'steps' of the 'circular staircase'.
p.42
Bacterial Chromosomes and Plasmids
What are the most abundant transposable elements in humans called?
LINEs (long interspersed nuclear elements).
p.40
Eukaryotic DNA Packaging and Chromatin Structure
What are the two types of tandemly repeated DNA mentioned?
Centromeric and telomeric DNA.
p.21
Watson and Crick's Double Helix Model
What type of double helices are most RNA structures?
Most RNA double helices are of the A type.
p.31
Histone Modifications and Gene Regulation
What happens when lysine 27 is methylated?
It leads to the recruitment and activation of enzymes that methylate adjoining DNA, coupling gene silencing alterations.
p.34
Histone Modifications and Gene Regulation
How do SWI/SNF remodelers interact with histones?
They have domains that bind the acetylated tails of histone proteins.
p.40
Eukaryotic DNA Packaging and Chromatin Structure
Give an example of a simple-sequence repeated DNA.
Built from the five-base unit GTTAC: . . . GTTACGTTACGTTACGTTACGTTAC . . .
p.17
Chargaff's Rules and Base Pairing
What does it mean for the two chains of the DNA double helix to be complementary?
The base sequence of one chain determines the base sequence of the other chain.
p.12
Avery's Contribution to DNA as Genetic Material
What larger group of viruses carries their genetic material as RNA?
A much larger group of viruses compared to those with single-stranded DNA.
p.28
Nucleosomes and Chromatin Fiber Formation
What role does histone H1 play in chromatin structure?
It facilitates the packing of nucleosomes into the 30-nm fiber.
p.34
Nucleosomes and Chromatin Fiber Formation
What is the SWI/SNF family?
An important class of remodelers that slide nucleosomes or eject them from chromatin.
p.20
Watson and Crick's Double Helix Model
How does Z-DNA compare in size to B-DNA?
Z-DNA is longer and thinner than B-DNA.
p.23
Eukaryotic DNA Packaging and Chromatin Structure
What is the relationship between the mass of histones and DNA in chromatin?
In most cells, the mass of histones is approximately equal to the mass of DNA.
p.18
Watson and Crick's Double Helix Model
What are the free ends of the first and last nucleotides in a DNA strand?
The first nucleotide has a free 5' end, and the last nucleotide has a free 3' end.
p.24
Histone Modifications and Gene Regulation
What additional proteins are found in chromatin besides histones?
A diverse group of nonhistone proteins.
p.37
Eukaryotic DNA Packaging and Chromatin Structure
How long has the TTAGGG sequence been conserved?
Over hundreds of millions of years of evolution.
p.38
Eukaryotic DNA Packaging and Chromatin Structure
How do eukaryotes differ from bacteria in terms of DNA repetition?
Eukaryotes exhibit large variations in their amounts of repeated versus nonrepeated DNA.
p.20
Watson and Crick's Double Helix Model
In which regions does Z-DNA most readily arise?
In DNA regions with alternating purines and pyrimidines or cytosines with extra methyl groups.
p.60
Bacterial Chromosomes and Plasmids
What role do RNAs and proteins play in bacterial DNA structure?
They help hold the loops in place.
